Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_102598 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Pituitary Adenomas | ICD-10 | - (-) |
DBLink | PMID | 31261542 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Tumor samples were obtained from patients who underwent transsphenoidal surgery or craniotomy for NFPA resection |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ttcttcatactatcggagacag Reversetggccgatgttgtacattcg | Statistics | Fold Change : Upregulated pvalue : <0.05 |
Citation | |||
Hu, Y, Zhang, N, Zhang, S, Zhou, P, Lv, L, Richard, SA, Ma, W, Chen, C, Wang, X, Huang, S, Jiang, S (2019). Differential circular RNA expression profiles of invasive and non-invasive non-functioning pituitary adenomas: A microarray analysis. Medicine (Baltimore), 98, 26:e16148. |